ZNF460 / ZNF317-like

The factors

ZNF460 and ZNF317 are human C2H2 zinc-finger proteins with tandem finger arrays. Neither has been the subject of a dedicated structural or biochemical study, and the literature on them is thin enough that this entry is mostly a description of data quality rather than of biology. They are grouped as one family because their motifs are nearest neighbours across the four databases, not because anyone has demonstrated shared specificity; the pairing should be read as a statement about matrix similarity. Both fall within the broad class of zinc-finger proteins surveyed in genome-wide characterizations of human KRAB and non-KRAB zinc fingers, where hundreds of members were assayed at once by ChIP-exo and related methods ^{28273063,37730438}. They are broadly but not highly expressed. There is no reported dimerization, no described cofactor, and no knockout phenotype in a mammalian model for either gene.

The motif

This family has the lowest cohesion in the batch (0.49 on the atlas's internal scale), and the reason is visible in the matrices. They fall into two groups that have nothing in common. The first is long and AT/AC-mixed: the CIS-BP ZNF317 matrix reads GAGAAGTCAGCTGTCADTCTTAT, the Vierstra archetype AC0085 reads AGTCTGCTGT, one ChIP-derived HOCOMOCO ZNF317 matrix reads GAHTGACAGCTGACTTCTCA, and JASPAR MA1593.2 reduces this to ACAGCAGA. The second group is GC-rich: JASPAR MA1596.1 for ZNF460 reads GCCTCAGCCTCCCGAG, the CIS-BP ZNF460 matrix reads CGCCGCCTCCCC, and the low-grade HOCOMOCO ZNF460 matrix reads GGGGGGCG. The GCCTCAGCCTCCC word is worth naming for what it is: that sequence is a near-exact match to a well-known segment of the Alu consensus, so a matrix built on it will report Alu copies rather than a specific protein-DNA preference. The second ChIP-derived ZNF317 matrix (ATGGAAGCCAGAAGACAATGGAA) has no close neighbour anywhere in the collection. For this reason no consensus field is given for this family: quoting either group as the consensus would misrepresent the data, and averaging them would be meaningless.

Where it acts

There is little to say that rests on evidence. If the GC-rich ZNF460 matrices are reporting Alu sequence, then matches will be distributed like Alus: hundreds of thousands of copies, concentrated in gene-rich, GC-rich regions and in introns, and heavily represented near promoters simply because Alus are. The AGTCTGCTGT-type ZNF317 word is longer and less repeat-like, and would be expected to occur at more modest frequency, but no published mapping study describes where ZNF317 actually binds in a genome or which genes it regulates. Neither protein has a named composite element or an established partner. Surveys of human zinc-finger proteins provide the only genome-scale occupancy context, and they treat these two as members of a large set rather than as individually characterized factors.

Biology and disease

Direct functional work is limited to recent cancer and vascular papers, all of which study the protein rather than the motif. ZNF460 has been reported to inhibit HMGCL and activate PI3K signalling in colon cancer ^41969486, to act downstream of KMT2D in a COL9A1-dependent extracellular-matrix stiffening mechanism that maintains a colorectal cancer stem-cell pool ^40591048, and to promote GSDME-driven pyroptosis through transcriptional activation of PKM2 in aortic dissection ^41923736. These studies identify target genes but do not establish a binding consensus, so they cannot be used to validate the matrices above. ZNF317 has no comparable literature. Neither gene is a recognized Mendelian disease gene or a recurrent cancer driver, and neither appears among the primate-specific KRAB zinc fingers whose control of endogenous retroviruses has been worked out in detail. Where the literature is this thin, the right summary is that these are annotated but essentially uncharacterized factors.

Reading a hit

Be cautious to the point of scepticism. First, decide which of the two motif groups your hit belongs to, because they are not the same element and the family label hides that. If the match is to the GC-rich GCCTCAGCCTCCC-type word, check whether it falls in an Alu; if it does, the hit is almost certainly reporting the repeat and not ZNF460 occupancy. If the match is to the longer AGTCTGCTGT-type word, you have a more specific sequence but almost no functional literature to interpret it against. Second, look at the evidence codes. The ZNF460 HOCOMOCO matrix is grade C with in vitro (S) evidence only and is a low-information G-run; the ZNF317 HOCOMOCO matrices are ChIP-only (P, grade B) and disagree with each other. Third, do not report a hit as identifying ZNF460 versus ZNF317: the grouping itself is data-driven, and nothing in the literature says these two proteins share a site. A match in this family is best treated as a flag to inspect the underlying sequence manually rather than as an assignment to a factor.